rs58581774 chr2:241078453 C>T
- Sequence
atggtatatccactcaatggaaca[C/T]gattcaaccataaaacaaggacgc
- ASB in cell types
- GM19099 (female B-cells Lymphoblastoid Cell Lines) GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM19099 (female B-cells Lymphoblastoid Cell Lines) | -0.19 | 2.01 | 1.00 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 2.12 | -1.77 | 1.50 |
Items per page:
1 – 2 of 2