rs58697123 chr14:71753343 T>C
- Sequence
atcctgaaggcaagaagactgggc[T/C]cagagccaggggccctcccgggat
- ASB in cell types
- A549 (lung carcinoma) neutrophils from periferal blood upper lobe of left lung H929 (plasma cell myeloma)
- ASB for transcription factors
- SMC3_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SMC3_HUMAN | 0.29 | 1.46 | 1.89 | n/a | n/a |
Items per page:
1 – 1 of 1