rs58752284 chr6:32894110 G>C
- Sequence
cggcaccgagagaagagaaactac[G/C]ctagaggaaaagctcgagctgtta
- ASB in cell types
- primary B-CLL cells
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| primary B-CLL cells | 2.44 | n/a | 3.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Tibial, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Nerve_Tibial, Whole_Blood