rs58780098 chr20:31569361 C>A
- Sequence
gcagcaggatacctccagccaggc[C/A]tctgtggcctctgtttccttctcc
- ASB in cell types
- GM19238 (female B-cells lymphoblastoid cell lines) GM18486 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM19238 (female B-cells lymphoblastoid cell lines) | -2.72 | 2.71 | 1.17 | |||
| GM18486 (Lymphoblastoid Cell Lines) | -1.95 | 2.39 | 1.00 |
Items per page:
1 – 2 of 2