rs58811869 chr2:43950562 G>C
- Sequence
agcaccttatgatttgcaatatta[G/C]agggacttacctcgctccaaagat
- ASB in cell types
- GM17942 (lymphoblastoid cell)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM17942 (lymphoblastoid cell) | 1.64 | -1.40 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Caudate_basal_ganglia, Brain_Cerebellum, Cells_Cultured_fibroblasts, Esophagus_Muscularis, Lung, Muscle_Skeletal, Spleen, Thyroid