rs58816127 chr8:48083742 C>G
- Sequence
gcagacagactggggttcacactg[C/G]catgggcgctggcagccacatcgg
- ASB in cell types
- LNCaP C4-2B (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| LNCaP C4-2B (prostate carcinoma) | -2.34 | 2.29 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cortex, Brain_Frontal_Cortex_BA9, Esophagus_Mucosa, Muscle_Skeletal, Skin_Sun_Exposed_Lower_leg, Testis