rs58837341 chr19:1248921 G>T
- Sequence
ctggttgccgttccgccctccgtt[G/T]cccagccacacggtcccagtctcc
- ASB in cell types
- K562 (myelogenous leukemia) neutrophils erythroid cells
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.74 | 0.29 | 1.98 | |||
| neutrophils | -0.66 | 2.91 | 2.00 | |||
| erythroid cells | 2.33 | -4.24 | 1.50 |
Items per page:
1 – 3 of 3