rs58872621 chr15:37995856 C>A
- Sequence
atgcaatcccctccaaaaaaaaaa[C/A]aaacaaacaaacaaaacctgtatt
- ASB in cell types
- thyroid gland foreskin keratinocyte uterus HCAEC (human coronary artery endothelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| thyroid gland | 2.46 | -2.49 | 1.00 | |||
| foreskin keratinocyte | 1.16 | n/a | 3.00 | |||
| uterus | 2.28 | -1.98 | 1.00 | |||
| HCAEC (human coronary artery endothelial cells) | 2.30 | -1.98 | 1.00 | |||
| GM19238 (female B-cells lymphoblastoid cell lines) | -0.41 | 0.47 | 1.00 |
Items per page:
1 – 5 of 5