rs58969530 chr21:42465292 T>G
- Sequence
cagctgttctgctggaattcagga[T/G]ctgcttaagcaattcttaaacaga
- ASB in cell types
- HCASMC (Human coronary artery smooth muscle cells) MDM(monocyte derived macrophages) monocyte-derived macrophages from peripheral blood
- ASB for transcription factors
- SPI1_HUMAN TCF21_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 2.11 | -1.32 | 2.00 | n/a | No Hit | |||
| TCF21_HUMAN | 1.97 | n/a | 3.00 | n/a | No Hit |
Items per page:
1 – 2 of 2