rs58976422 chr13:84917538 T>C
- Sequence
tctattaacatgctattatattta[T/C]gactataaaacaggaaacttgtat
- ASB in cell types
- GM19240 (B cells Lymphoblastoid Cell Lines) GM12892 (female B-cells lymphoblastoid cell line) thyroid gland
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM19240 (B cells Lymphoblastoid Cell Lines) | -2.15 | 2.42 | 1.00 | |||
| GM12892 (female B-cells lymphoblastoid cell line) | -0.91 | 1.77 | 1.00 | |||
| thyroid gland | -0.20 | 1.74 | 1.17 |
Items per page:
1 – 3 of 3