rs58981291 chr2:71466675 T>C
- Sequence
ccagcgggtgtccggtgtcctccc[T/C]gcagcctctcccaggcattggtca
- ASB in cell types
- MDA-MB-231p27CK-DD (breast cancer cells, phosphimimetic p27 cell line)
- ASB for transcription factors
- CDN1B_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CDN1B_HUMAN | 0.04 | 1.34 | 2.00 | n/a | n/a |
Items per page:
1 – 1 of 1