rs59004042 chr10:131454233 T>G
- Sequence
ggaagagctgcgccagcttgctca[T/G]gcttctccctcggcccctcccacg
- ASB in cell types
- GM19193 (female B-cells Lymphoblastoid Cell Lines) GM18951 (B-cells Lymphoblastoid Cell Lines) GM10847 (female B-cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM19193 (female B-cells Lymphoblastoid Cell Lines) | 2.24 | -2.00 | 1.00 | |||
| GM18951 (B-cells Lymphoblastoid Cell Lines) | -1.39 | 1.55 | 1.00 | |||
| GM10847 (female B-cells Lymphoblastoid Cell Lines) | -0.50 | 1.41 | 1.00 |
Items per page:
1 – 3 of 3