rs59005995 chr2:106561008 A>G
- Sequence
atggcagtgtttccgggtgtcagc[A/G]gggatatgtttgccttgggaagtt
- ASB in cell types
- breast tumor 22RV1 (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| breast tumor | 2.13 | -1.40 | 2.00 | |||
| 22RV1 (prostate carcinoma) | 2.01 | -0.24 | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Cortex, Breast_Mammary_Tissue, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis