rs59033795 chr5:181192093 T>A
- Sequence
caggattggggagcacgttttgcg[T/A]cttgctgtgcgtgaggaagcgggg
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) MDA-MB-157 (triple negative breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | 0.23 | 1.33 | 2.97 | |||
| MDA-MB-157 (triple negative breast carcinoma) | 1.79 | -1.06 | 1.00 |
Items per page:
1 – 2 of 2