rs59103437 chr18:35523590 C>T
- Sequence
ggagcttcacctgctccccccagg[C/T]agctaccgaatgagagtctctgca
- ASB in cell types
- LNCaP (prostate carcinoma) LNCaP95
- ASB for transcription factors
- FOXA1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOXA1_HUMAN | 1.86 | -0.61 | 1.62 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Brain_Cerebellar_Hemisphere, Esophagus_Mucosa, Skin_Not_Sun_Exposed_Suprapubic