rs59114959 chr11:7666034 A>T
- Sequence
ttgctgggatgctgtctgggctgc[A/T]gcagctgtctgggggctcagcatg
- ASB in cell types
- gastroesophageal sphincter A549 (lung carcinoma) esophagus squamous epithelium KMS-11 (Plasma cell myeloma)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.30 | 1.05 | 1.36 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Cells_Cultured_fibroblasts, Muscle_Skeletal, Stomach, Thyroid