rs59173829 chr14:94307686 A>T
- Sequence
aaatggatccctagcatcgcccag[A/T]cacaggttcacacccacgcatata
- ASB in cell types
- foreskin keratinocyte bipolar neuron IPSC-derived bipolar neuron
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 1.83 | -3.85 | 2.11 | |||
| bipolar neuron | -1.69 | 1.69 | 1.00 | |||
| IPSC-derived bipolar neuron | -0.35 | 2.52 | 1.00 |
Items per page:
1 – 3 of 3