rs59180337 chr19:2952959 T>G
- Sequence
ccgagatcgtgccactgcactcca[T/G]cctgtgtgacagagtaagactctc
- ASB in cell types
- foreskin keratinocyte GM12891 (male B- cells lymphoblastoid cell line) GM12892 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | -1.09 | 2.13 | 2.17 | |||
| GM12891 (male B- cells lymphoblastoid cell line) | 2.41 | -2.11 | 1.00 | |||
| GM12892 (female B-cells lymphoblastoid cell line) | 1.76 | -1.67 | 1.00 |
Items per page:
1 – 3 of 3