rs59180736 chr8:127163809 G>C
- Sequence
tgtcagtttgaattcttgctgttt[G/C]tatttgtttagttctaaagccttc
- ASB in cell types
- GM02255 (Lymphoblastoid Cell Lines) GM18486 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM02255 (Lymphoblastoid Cell Lines) | 0.71 | -0.32 | 1.00 | |||
| GM18486 (Lymphoblastoid Cell Lines) | 0.13 | 1.06 | 1.00 |
Items per page:
1 – 2 of 2