rs59198765 chr11:64162994 G>A
- Sequence
aattagccgggcgtgatggcacgc[G/A]tctgtaatcccagctactggggag
- ASB in cell types
- HEK293 (embryonic kidney)
- ASB for transcription factors
- ZN600_HUMAN ZN629_HUMAN ZN366_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZN600_HUMAN | 3.51 | -3.18 | 1.00 | n/a | n/a | |||
| ZN629_HUMAN | 3.25 | n/a | 1.00 | n/a | n/a | |||
| ZN366_HUMAN | 3.05 | n/a | 1.00 | n/a | n/a |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Testis, Whole_Blood