rs59218377 chr12:53180847 A>C
- Sequence
ggccgcgcctggcaggtaggagca[A/C]gccccaaagaccgcagcgtcgtcc
- ASB for transcription factors
- HIF1A_HUMAN BRD4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| HIF1A_HUMAN | -3.28 | 1.99 | 1.50 | 5.00 | Concordant | |||
| BRD4_HUMAN | 1.40 | 0.22 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Nucleus_accumbens_basal_ganglia, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Lung, Nerve_Tibial, Small_Intestine_Terminal_Ileum, Stomach, Thyroid, Whole_Blood