rs59227598 chr3:168096432 A>G
- Sequence
ggcagacacatgggatagctacat[A/G]gcacaatcccggtagtcaaaccag
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 0.95 | 0.65 | 1.01 | |||
| foreskin keratinocyte | 2.06 | -1.33 | 2.00 |
Items per page:
1 – 2 of 2