rs59238099 chr16:56617248 A>T
- Sequence
agcaaccacaaggaaatggggaat[A/T]tggggaagttgcgcgggcaggacg
- ASB in cell types
- CD14+ monocytes
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| CD14+ monocytes | 1.75 | -0.47 | 4.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Cells_Cultured_fibroblasts, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Heart_Atrial_Appendage, Minor_Salivary_Gland, Skin_Sun_Exposed_Lower_leg, Thyroid