rs59252582 chr1:212951086 T>C
- Sequence
ctttcttctccccacatcttgcgc[T/C]ccgcatcccccaagctccttgtgc
- ASB in cell types
- BEAS-2B (bronchial epithelium) 22RV1 (prostate carcinoma) GM19240 (B cells Lymphoblastoid Cell Lines)
- ASB for transcription factors
- CTCF_HUMAN GCR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.70 | 0.52 | 1.17 | n/a | No Hit | |||
| GCR_HUMAN | 0.64 | 2.21 | 1.14 | n/a | No Hit |
Items per page:
1 – 2 of 2