rs59256765 chr15:66632139 G>A
- Sequence
gggtttagtccccagaaacagcag[G/A]cctggcctccctcagctgccccct
- ASB in cell types
- HEK293 (embryonic kidney)
- ASB for transcription factors
- ZIC2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZIC2_HUMAN | 1.81 | -2.88 | 1.50 | -3.94 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
