rs59309066 chr1:2786921 G>C
- Sequence
aggacccaaaccgggccccagggg[G/C]aggaagacgcgagaaggccctcac
- ASB in cell types
- GM02610 (Lymphoblastoid Cell Lines) GM19240 (B cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM02610 (Lymphoblastoid Cell Lines) | 2.07 | -1.17 | 1.00 | |||
| GM19240 (B cells Lymphoblastoid Cell Lines) | -0.78 | 2.05 | 1.00 |
Items per page:
1 – 2 of 2