rs59362027 chr17:74567547 G>A
- Sequence
agttcttcctaataaaacatgttt[G/A]catttgctgttcctctttctgttc
- ASB in cell types
- macrophages form periferal blood
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| macrophages form periferal blood | 1.84 | -0.07 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Brain_Cerebellum, Colon_Transverse, Lung, Nerve_Tibial, Spleen, Testis, Whole_Blood