rs59403483 chrX:49043986 G>C
- Sequence
agccaaagccataactatgaggca[G/C]aggcagctacattccctgaaggtg
- ASB in cell types
- GM19238 (female B-cells lymphoblastoid cell lines)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM19238 (female B-cells lymphoblastoid cell lines) | 1.59 | n/a | 5.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Nucleus_accumbens_basal_ganglia, Esophagus_Muscularis, Skin_Sun_Exposed_Lower_leg, Testis