rs59447204 chr19:7208286 G>T
- Sequence
atctaaagatcaaaggtgtttctt[G/T]gttctcacatagaaatccccccct
- ASB in cell types
- CTV-1 (Adult T acute lymphoblastic leukemia) GM12878 (female B-cells lymphoblastoid cell line) HepG2 (hepatoblastoma)
- ASB for transcription factors
- SPI1_HUMAN FLI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 1.39 | 0.52 | 1.00 | n/a | No Hit | |||
| FLI1_HUMAN | 2.47 | -0.65 | 1.00 | n/a | No Hit |
Items per page:
1 – 2 of 2