rs59448769 chr1:26378545 G>A
- Sequence
ctccacaggcagagctgagggtgg[G/A]gctgacagtgctcttgcctggctc
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) CD34+ hematopoietic stem cells
- ASB for transcription factors
- TIF1B_HUMAN IKZF1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TIF1B_HUMAN | 2.94 | n/a | 2.00 | n/a | n/a | |||
| IKZF1_HUMAN | -0.34 | 1.05 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Cerebellum, Lung, Muscle_Skeletal, Ovary, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid