rs59449271 chr13:113446226 G>T
- Sequence
ttggctgtgaaccccctagagagc[G/T]ctcagggccctgcagctgcaaacc
- ASB in cell types
- NALM-6 (adult B acute lymphoblastic leukemia)
- ASB for transcription factors
- COE1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| COE1_HUMAN | -2.56 | 1.68 | 1.50 | 2.91 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GTEx eQTL Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Muscularis, Muscle_Skeletal, Nerve_Tibial, Prostate, Thyroid, Whole_Blood