rs59451701 chr4:174120573 T>C
- Sequence
tgtgcgtgtgtgtgcgcgtgtgtg[T/C]gtgcgcgtgcgtgcgtgtgtgtgc
- ASB in cell types
- HepG2 (hepatoblastoma) GM12878 (female B-cells lymphoblastoid cell line) spleen
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | -0.27 | 1.54 | 1.17 | |||
| GM12878 (female B-cells lymphoblastoid cell line) | 2.04 | -1.84 | 1.00 | |||
| spleen | -1.61 | 1.99 | 1.00 |
Items per page:
1 – 3 of 3