rs59476302 chr16:579006 C>T
- Sequence
agaggctccggctgggcgggcgtt[C/T]gagtggggcgggggcggggcgggg
- ASB in cell types
- GM02255 (Lymphoblastoid Cell Lines) MS-1 (Small cell lung carcinoma) GM19240 (B cells Lymphoblastoid Cell Lines) Kelly (neuroblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM02255 (Lymphoblastoid Cell Lines) | 1.47 | -1.18 | 1.00 | |||
| MS-1 (Small cell lung carcinoma) | 2.07 | n/a | 3.00 | |||
| GM19240 (B cells Lymphoblastoid Cell Lines) | 1.42 | -0.38 | 1.33 | |||
| Kelly (neuroblastoma) | 2.06 | n/a | 1.00 |
Items per page:
1 – 4 of 4