rs59476606 chr17:309269 G>A
- Sequence
tgtttgccactgcactccagcctg[G/A]gcggcagagctagaccttgtctct
- ASB in cell types
- GM02255 (Lymphoblastoid Cell Lines) MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM02255 (Lymphoblastoid Cell Lines) | 2.62 | -2.34 | 1.00 | |||
| MCF7 (Invasive ductal breast carcinoma) | -0.15 | 2.01 | 1.17 |
Items per page:
1 – 2 of 2