rs59484342 chr14:106694785 C>T
- Sequence
agcgcccccccccccccccccccc[C/T]ggtggctccagcacgctgacgtgt
- ASB in cell types
- 2588 (Lymphoblastoid Cell Lines) ID00014 (lymphoblastoid cell, DiGeorge syndrome) ID00015 (lymphoblastoid cell)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.06 | 2.05 | 1.50 | 3.41 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
