rs59506633 chr19:46513627 C>T
- Sequence
gttctgagccggcgctttagccag[C/T]ggtcctgcagcgccccctggtggg
- ASB in cell types
- E14 retina CD34+ hematopoietic stem cells LUHMES (lund human mesencephalic cells)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| E14 retina | 2.72 | -4.72 | 1.50 | |||
| CD34+ hematopoietic stem cells | 2.51 | -4.74 | 2.00 | |||
| LUHMES (lund human mesencephalic cells) | 1.33 | -0.26 | 1.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Cells_Cultured_fibroblasts, Skin_Sun_Exposed_Lower_leg, Testis