rs59519586 chr4:2413395 G>A
- Sequence
gcatgacctggatgcagagccgcc[G/A]ggggagccccagagccttctgaat
- ASB in cell types
- GM18505 (female B-cells Lymphoblastoid Cell Lines)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | -1.54 | 2.15 | 1.00 | -0.01 | Weak Discordant |
Items per page:
1 – 1 of 1
Motif analysis
