rs59529296 chr3:98786685 T>G
- Sequence
ttagagatggttatgcaatcaggg[T/G]tttttttttgtttgttttcttctt
- ASB in cell types
- SUM159PT (Triple negative breast cancer) liver
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| SUM159PT (Triple negative breast cancer) | -5.04 | 1.66 | 2.50 | |||
| liver | 1.30 | -1.26 | 1.00 |
Items per page:
1 – 2 of 2