rs59540665 chr16:807697 C>A
- Sequence
gggctggccccagggcgtggcggg[C/A]cctcggggcagtcgcccagaccac
- ASB in cell types
- HEK293 (embryonic kidney) primary B-CLL cells LNCaP C4-2B (prostate carcinoma)
- ASB for transcription factors
- BRD4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| BRD4_HUMAN | 1.19 | 0.23 | 1.43 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Liver, Lung, Pituitary, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid