rs59547678 chr4:140253300 G>C
- Sequence
caggggtgggggcggcgagacccc[G/C]gctctgggctcggccccgcgctcc
- ASB in cell types
- erythroid cells transverse colon
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| erythroid cells | 3.69 | n/a | 2.00 | |||
| transverse colon | 1.97 | 0.13 | 1.00 |
Items per page:
1 – 2 of 2