rs59658986 chr1:12014470 T>C
- Sequence
tttcaaggcagcagccaaagactt[T/C]ctcaggtaacaaaaaaaaaatgaa
- ASB in cell types
- GM19239 (male B-cells lymphoblastoid cell line) 2588 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM19239 (male B-cells lymphoblastoid cell line) | -2.80 | 2.82 | 1.00 | |||
| 2588 (Lymphoblastoid Cell Lines) | 2.10 | -2.14 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Spinal_cord_cervical_c-1, Cells_Cultured_fibroblasts, Muscle_Skeletal, Skin_Sun_Exposed_Lower_leg