rs59692263 chr9:96317393 C>A
- Sequence
cctttccataccacttctccacct[C/A]cagcacccccaactaaccttagtt
- ASB in cell types
- esophagus squamous epithelium gastroesophageal sphincter
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| esophagus squamous epithelium | 2.27 | 1.19 | 1.11 | |||
| gastroesophageal sphincter | -1.11 | 1.44 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Brain_Spinal_cord_cervical_c-1, Cells_Cultured_fibroblasts, Colon_Transverse, Liver, Nerve_Tibial, Pancreas, Small_Intestine_Terminal_Ileum, Testis, Thyroid