rs59720412 chr5:173973381 G>C
- Sequence
caatgtcagctgagcaagacaaag[G/C]ctccccgcttccaatcagcccttc
- ASB in cell types
- foreskin keratinocyte A549 (lung carcinoma) upper lobe of left lung
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 0.51 | n/a | 2.50 | |||
| A549 (lung carcinoma) | 0.55 | 0.92 | 2.00 | |||
| upper lobe of left lung | 0.65 | -0.65 | 1.00 |
Items per page:
1 – 3 of 3