rs59746776 chr4:90025578 A>T
- Sequence
tgaactgagtctaaccgaaaaaat[A/T]aaaaaaccaccaacaccacatccc
- ASB in cell types
- MS-1 (Small cell lung carcinoma) 2588 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MS-1 (Small cell lung carcinoma) | -0.93 | 0.93 | 1.00 | |||
| 2588 (Lymphoblastoid Cell Lines) | 1.06 | -1.06 | 1.00 |
Items per page:
1 – 2 of 2