rs59775802 chr6:150071206 G>C
- Sequence
ggtggttggaagctgagtgaacca[G/C]tgaatgaatgagacagttgtggga
- ASB in cell types
- K562 (myelogenous leukemia) GM19099 (female B-cells Lymphoblastoid Cell Lines) CUTLL1 (T-cell lymphoblastic lymphoma 1)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.88 | 0.61 | 1.08 | |||
| GM19099 (female B-cells Lymphoblastoid Cell Lines) | -1.71 | 1.65 | 1.00 | |||
| CUTLL1 (T-cell lymphoblastic lymphoma 1) | 2.68 | -1.91 | 1.00 |
Items per page:
1 – 3 of 3