rs59782300 chr5:174409251 A>G
- Sequence
ttctttcttcctaacaaaatctca[A/G]ttctgtccaagtagctctgctgcc
- ASB in cell types
- 2588 (Lymphoblastoid Cell Lines) GM19238 (female B-cells lymphoblastoid cell lines)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| 2588 (Lymphoblastoid Cell Lines) | -0.40 | 1.94 | 1.00 | |||
| GM19238 (female B-cells lymphoblastoid cell lines) | -0.15 | 1.73 | 1.11 |
Items per page:
1 – 2 of 2