rs5987107 chrX:153610129 A>G
- Sequence
cttgacgctgagtccggcgaacta[A/G]gctcgccacccccaccccatcccc
- ASB in cell types
- GM18526 (B – cells Lymphoblastoid Cell Lines) GM19238 (female B-cells lymphoblastoid cell lines) GM19099 (female B-cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM18526 (B – cells Lymphoblastoid Cell Lines) | n/a | 2.76 | 2.00 | |||
| GM19238 (female B-cells lymphoblastoid cell lines) | -0.10 | 2.37 | 2.00 | |||
| GM19099 (female B-cells Lymphoblastoid Cell Lines) | 2.72 | n/a | 2.00 |
Items per page:
1 – 3 of 3