rs5995444 chr22:37527430 T>C
- Sequence
ttagcttttttataggcagagagg[T/C]gctaaagagggcagagacagagaa
- ASB for transcription factors
- ZN341_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZN341_HUMAN | -1.61 | 2.66 | 2.00 | 0.81 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GTEx eQTL Cells_Cultured_fibroblasts, Esophagus_Mucosa, Nerve_Tibial, Pancreas, Stomach, Whole_Blood