rs5998181 chr22:31937513 G>T
- Sequence
tacaggagttggccttctcatgtg[G/T]ctgtggtcctctcagatcccttta
- ASB in cell types
- CD34+ hematopoietic stem cells-derived proerythroblasts
- ASB for transcription factors
- TAL1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TAL1_HUMAN | 3.07 | -5.41 | 2.00 | 2.20 | Discordant |
Items per page:
1 – 1 of 1
Motif analysis
