rs6002687 chr22:42314086 G>C
- Sequence
ctacatagcgcctgcaacaaggca[G/C]atacaggctcagcagggagccccg
- ASB in cell types
- HMEC (human mammary epithelial cells) GM18526 (B – cells Lymphoblastoid Cell Lines) GM02610 (Lymphoblastoid Cell Lines) RPMI8226 (Plasma cell myeloma)
- ASB for transcription factors
- STAG2_HUMAN IKZF1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG2_HUMAN | 2.49 | -2.48 | 1.00 | n/a | n/a | |||
| IKZF1_HUMAN | -1.74 | 2.53 | 2.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Heart_Atrial_Appendage, Lung, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Whole_Blood